7/28/2023 0 Comments Harvard 10x chromium![]() As part of the resolution, 10x and Bio-Rad desire to cross-license the other and its Affiliates (as defined below) to certain patents, all on the terms and conditions set forth in this Agreement and D. The Parties desire to reach a business resolution of disputes between them, including final settlement of the Litigation, without either Party making any admission of infringement, liability or wrongdoing of any kind and without the expenditure of further time and expense with respect thereto C. 10x and Bio-Rad are currently parties to the litigations and proceedings described on Schedule 1 hereto (collectively, the “Litigation”) B. 10x and Bio-Rad are sometimes referred to herein individually as a “Party” and collectively as the “Parties.” BACKGROUND A. SETTLEMENT AND PATENT CROSS LICENSE AGREEMENT This SETTLEMENT AND PATENT CROSS LICENSE AGREEMENT (“Agreement”) is entered into as of J(the “Effective Date”) by and between 10x Genomics, Inc., a Delaware corporation, having a place of business at 6230 Stoneridge Mall Road, Pleasanton, CA 94588 (“10x”) and Bio-Rad Laboratories, Inc., a Delaware corporation, having a place of business at 1000 Alfred Nobel Drive, Hercules, CA 94547 (“Bio-Rad”). (4) Add Truseq Read 2 primer to sequence the UMI (top strand as template, sequence UMI, 10 cycles):ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.SETTLEMENT AND PATENT CROSS LICENSE AGREEMENT Exhibit 10.1 Certain information has been excluded from this exhibit because it (i) is not material and (ii) would be competitively harmful if publicly disclosed. (3) Cluster regeneration, add Sample index sequencing primer (index2) to sequence the sample index (i5) (top strand as template, 8 cycles)::ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) NNNNNNNNNN AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNNNNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3' (2) Add Cell barcode sequencing primer to sequence the cell barcode (bottom strand as template, in this case, cell barcode = i7 index, 14 cycles):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-> Step-by-step library generation (1) mRNA capture using Beads-oligo-dT in the droplets, and reverse transcription using MMLV:ĥ'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXXXXNV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'-|ĥ'- TCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG*A -3'ģ'- CGAGAAGGCTAGAXXX.XXXV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNN TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX.XXXV(dT) NNNNNNNNNN TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNNNNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Sample index sequencing primer (index2): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3' SI-PCR Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'Ĭell barcode sequencing primer (index1): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' ![]() Truseq adapter (double stranded DNA with a T overhang): Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3' ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGTACAT -3′ ![]() Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3' This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.īeads-oligo-dT: |-5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (T) 30VN -3' You can find out all the cell barcodes (14 bp) here: 737K-april-2014_rc.txt.gz. Based on their the v1 manual PDF and actual data, I think the information in this page is accurate. I cannot find the exact sequence information from the 10x website, so sequences shown here is based on educational guess. The Chromium Single Cell 3’ Solution v1 chemistry is obsolete and superseded by the v2 chemistry. 10x Chromium Single Cell 3' Solution v1 10x Chromium Single Cell 3' Solution v1
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |